-
PurposeExpresses LAR-GECO1 in the endoplasmic reticulum in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61244 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCustomized Vector
- Backbone size w/o insert (bp) 3200
- Total vector size (bp) 4514
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLAR-GECO1
-
Alt namelow affinity red intensiometric genetically encoded Ca2+-indicators for optical
-
SpeciesSynthetic
-
Insert Size (bp)1248
-
MutationSubstitutions relative to R-GECO1: V51W/I113V/N356S/D363Y/D381Y/F395A/V411A/L415I
-
GenBank IDKP091742
- Promoter CMV
-
Tags
/ Fusion Proteins
- ER-targeting sequence: MLLPVPLLLGLLGAAAD (N terminal on insert)
- ER-retention sequence: KDEL (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The construct is numbered based on GCaMP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-ER-LAR-GECO1 was a gift from Robert Campbell (Addgene plasmid # 61244 ; http://n2t.net/addgene:61244 ; RRID:Addgene_61244) -
For your References section:
Red fluorescent genetically encoded Ca2+ indicators for use in mitochondria and endoplasmic reticulum. Wu J, Prole DL, Shen Y, Lin Z, Gnanasekaran A, Liu Y, Chen L, Zhou H, Chen SR, Usachev YM, Taylor CW, Campbell RE. Biochem J. 2014 Nov 15;464(1):13-22. doi: 10.1042/BJ20140931. 10.1042/BJ20140931 PubMed 25164254