Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pOTTC813 - pAAV-SYN1-CRTsigpep-GCaMP3-KDEL
(Plasmid #63886)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 63886 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ER-localized GCaMP3(wt)
  • Species
    Synthetic
  • Promoter human SYN1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site bamhi (unknown if destroyed)
  • 3′ cloning site ecori (unknown if destroyed)
  • 5′ sequencing primer hSYN1 F417 actcagcgctgcctcagtct
  • 3′ sequencing primer WPRE_R1
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC813 - pAAV-SYN1-CRTsigpep-GCaMP3-KDEL was a gift from Brandon Harvey (Addgene plasmid # 63886 ; http://n2t.net/addgene:63886 ; RRID:Addgene_63886)
  • For your References section:

    A Low Affinity GCaMP3 Variant (GCaMPer) for Imaging the Endoplasmic Reticulum Calcium Store. Henderson MJ, Baldwin HA, Werley CA, Boccardo S, Whitaker LR, Yan X, Holt GT, Schreiter ER, Looger LL, Cohen AE, Kim DS, Harvey BK. PLoS One. 2015 Oct 9;10(10):e0139273. doi: 10.1371/journal.pone.0139273. eCollection 2015. PONE-D-15-20579 [pii] PubMed 26451944