Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-hsyn-Jaws-KGC-GFP-ER2
(Plasmid #65014)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65014 Plasmid sent as bacteria in agar stab 1 $65
AAV8 65014-AAV8 Virus (100 µL at titer ≥ 7×10¹² vg/mL)
and Plasmid. More Information
$380
AAV Retrograde 65014-AAVrg Virus (100 µL at titer ≥ 7×10¹² vg/mL)
and Plasmid. More Information
$380

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4695
  • Total vector size (bp) 6351
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Please note that this backbone is highly recombination prone and should be amplified in a rec- strain like Sure2 or Stbl3, and grown at 30 C using carbenicillin rather than ampicillin.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Jaws-KGC-GFP-ER2
  • Alt name
    Jaws
  • Species
    Haloarcula salinarum (strain Shark)
  • Insert Size (bp)
    1650
  • Mutation
    K200R W214F
  • GenBank ID
    KM000926.1
  • Promoter human synapsin
  • Tags / Fusion Proteins
    • KGC (C terminal on insert)
    • GFP (C terminal on insert)
    • ER2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCG AGG CGC GAG ATA G
  • 3′ sequencing primer CAA GGA GGA GAA AAT GAA AGC C
  • (Common Sequencing Primers)

Resource Information

Information for AAV8 (Catalog # 65014-AAV8) ( Back to top )

Purpose

Ready-to-use AAV8 particles produced from pAAV-hsyn-Jaws-KGC-GFP-ER2 (#65014). In addition to the viral particles, you will also receive purified pAAV-hsyn-Jaws-KGC-GFP-ER2 plasmid DNA.

These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV8 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene GFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
      Syn For: CAAGCACCCAACCCCCATTCCC
      37825 Rev: GATATAGACGTTGTGGCTGTTGTAGTTG
    • Transgene
      Jaws Rev: CTGATCTGGGTGGCCACAAT
      37825 Rev: GATATAGACGTTGTGGCTGTTGTAGTTG

Visit our viral production page for more information.

Information for AAV Retrograde (Catalog # 65014-AAVrg) ( Back to top )

Purpose

Ready-to-use AAV Retrograde particles produced from pAAV-hsyn-Jaws-KGC-GFP-ER2 (#65014). In addition to the viral particles, you will also receive purified pAAV-hsyn-Jaws-KGC-GFP-ER2 plasmid DNA.

These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV retrograde cap gene
    rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAVrg rAAV2-retro helper (plasmid #81070)
  • Purification Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
      Syn For: CAAGCACCCAACCCCCATTCCC
      37825 Rev: GATATAGACGTTGTGGCTGTTGTAGTTG
    • Transgene
      Jaws Rev: CTGATCTGGGTGGCCACAAT
      37825 Rev: GATATAGACGTTGTGGCTGTTGTAGTTG

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hsyn-Jaws-KGC-GFP-ER2 was a gift from Edward Boyden (Addgene plasmid # 65014)
  • For your References section:

    Noninvasive optical inhibition with a red-shifted microbial rhodopsin. Chuong AS, Miri ML, Busskamp V, Matthews GA, Acker LC, Sorensen AT, Young A, Klapoetke NC, Henninger MA, Kodandaramaiah SB, Ogawa M, Ramanlal SB, Bandler RC, Allen BD, Forest CR, Chow BY, Han X, Lin Y, Tye KM, Roska B, Cardin JA, Boyden ES. Nat Neurosci. 2014 Aug;17(8):1123-9. doi: 10.1038/nn.3752. Epub 2014 Jul 6. 10.1038/nn.3752 PubMed 24997763