pCMT-flp
(Plasmid #67274)

• Purpose: Conjugally transferable Flp recombinase plasmid for unmarked mutagenesis
• Depositing Lab: Mark Liles
• Publication: Hossain et al Biotechnol Rep (Amst). 2015 Aug 28;8:24-35. doi: 10.1016/j.btre.2015.08.005. eCollection 2015 Dec.

Backbone

• Vector backbone: pRham-flp-tetA
• Backbone manufacturer: Hossain el al (Mark Liles lab)
• Backbone size w/o insert (bp): 3699
• Total vector size (bp): 5813
• Vector type: Flp recombinase plasmid, temperature sensitive

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): E. coli SM10lambdapir
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: tetA, flp, repA101, oriR101
• Insert Size (bp): 5813
• Promoter: tetA promoter of plasmid pACYC184 origin
• Tag / Fusion Protein:
  • His-SUMO (flp) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaAI (destroyed during cloning)
• 3′ cloning site: AlwNI (destroyed during cloning)
• 5′ sequencing primer: CGCATTCACAGTTCTCCGCAAG
• 3′ sequencing primer: CGAATCATCGGAAGAAGCAG

Resource Information

• Supplemental Documents:
  • GenBank accession number KT072898

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

conjugally transferable flp plasmid for unmarked mutagenesis pCMT-flp