Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
(Plasmid #68346)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 68346 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Amp
  • Backbone size w/o insert (bp) 2500
  • Total vector size (bp) 6200
  • Vector type
    Mammalian Expression, AAV ; Flp/Frt

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    3xgRNA;PTENA, p53B,SMAD4A
  • Species
    Synthetic
  • Insert Size (bp)
    1050
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer ttcgccacctctgacttgag
  • 3′ sequencing primer gggcgtacttggcatatgat
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    FlPO
  • Species
    Synthetic
  • Insert Size (bp)
    1300
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site AflII (unknown if destroyed)
  • 5′ sequencing primer tcctacttggcagtacatct
  • 3′ sequencing primer atcagcaaggagatgatcgc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 68346 ; http://n2t.net/addgene:68346 ; RRID:Addgene_68346)