AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
(Plasmid
#68346)
-
PurposeUsed to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 68346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAmp
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 6200
-
Vector typeMammalian Expression, AAV ; Flp/Frt
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert name3xgRNA;PTENA, p53B,SMAD4A
-
SpeciesSynthetic
-
Insert Size (bp)1050
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer ttcgccacctctgacttgag
- 3′ sequencing primer gggcgtacttggcatatgat (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFlPO
-
SpeciesSynthetic
-
Insert Size (bp)1300
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site AflII (unknown if destroyed)
- 5′ sequencing primer tcctacttggcagtacatct
- 3′ sequencing primer atcagcaaggagatgatcgc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 68346 ; http://n2t.net/addgene:68346 ; RRID:Addgene_68346)