R26TV LSL-TRL
(Plasmid
#68476)
-
PurposeRosa26 targeting vector expressing Cre-dependent tTR-KRAB-rtTA3-Luc cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68476 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneR26TV CAG LSL 2-5
- Backbone size w/o insert (bp) 14676
- Total vector size (bp) 18225
-
Vector typeMammalian Expression, Mouse Targeting, Cre/Lox, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametTR-KRAB-2A-rtTA3-2A-Luciferase
-
SpeciesH. sapiens (human); Escherichia coli Tn10
-
Insert Size (bp)3549
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTAACTCGAACGCTAGCTGTGCGATCGTTT
- 3′ sequencing primer AGAGTAATTCAACCCCAAACAACAACGTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
R26TV LSL-TRL was a gift from Tyler Jacks (Addgene plasmid # 68476 ; http://n2t.net/addgene:68476 ; RRID:Addgene_68476) -
For your References section:
A Modular Assembly Platform for Rapid Generation of DNA Constructs. Akama-Garren EH, Joshi NS, Tammela T, Chang GP, Wagner BL, Lee DY, Rideout Iii WM, Papagiannakopoulos T, Xue W, Jacks T. Sci Rep. 2016 Feb 18;6:16836. doi: 10.1038/srep16836. 10.1038/srep16836 PubMed 26887506