AAV-DeltaFosB
(Plasmid
#68545)
-
PurposeAAV expression of DeltaFosB
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 68545 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4650
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDeltaFosB-IRES-GFP
-
Alt nameFosB
-
Mutationtruncated splice variant of FosB
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pCAX-F CAGCTCCTGGGCAACGTGC
- 3′ sequencing primer hGH-PA-R CCAGCTTGGTTCCCAATAGA (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-DeltaFosB was a gift from Eric Nestler (Addgene plasmid # 68545 ; http://n2t.net/addgene:68545 ; RRID:Addgene_68545) -
For your References section:
An essential role for DeltaFosB in the nucleus accumbens in morphine action. Zachariou V, Bolanos CA, Selley DE, Theobald D, Cassidy MP, Kelz MB, Shaw-Lutchman T, Berton O, Sim-Selley LJ, Dileone RJ, Kumar A, Nestler EJ. Nat Neurosci. 2006 Feb;9(2):205-11. Epub 2006 Jan 15. 10.1038/nn1636 PubMed 16415864