Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

AAV-DeltaJunD
(Plasmid #68547)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 68547 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4650
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DeltaJunD-IRES-GFP
  • Alt name
    jun D proto-oncogene
  • Alt name
    JunD
  • Mutation
    truncated splice variant
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pCAX-F CAGCTCCTGGGCAACGTGC
  • 3′ sequencing primer hGH-PA-R CCAGCTTGGTTCCCAATAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-DeltaJunD was a gift from Eric Nestler (Addgene plasmid # 68547 ; http://n2t.net/addgene:68547 ; RRID:Addgene_68547)
  • For your References section:

    DeltaFosB induction in orbitofrontal cortex mediates tolerance to cocaine-induced cognitive dysfunction. Winstanley CA, LaPlant Q, Theobald DE, Green TA, Bachtell RK, Perrotti LI, DiLeone RJ, Russo SJ, Garth WJ, Self DW, Nestler EJ. J Neurosci. 2007 Sep 26;27(39):10497-507. 10.1523/JNEUROSCI.2566-07.2007 PubMed 17898221