Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pQE-WT-RGVG-M6
(Plasmid #70172)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 70172 Standard format: Plasmid sent in bacteria as agar stab 1 $75 *

* Login to view industry pricing.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use BL21-gold for protein expression in E. coli
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RGVG-M6 T7 RNA polymerase
  • Species
    T7 bacteriophage
  • Insert Size (bp)
    2685
  • Promoter T5/Lac
  • Tag / Fusion Protein
    • His (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACG
  • 3′ sequencing primer CATCTGGATTTGTTCAGAACGCTCGGTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQE-WT-RGVG-M6 was a gift from Andrew Ellington (Addgene plasmid # 70172 ; http://n2t.net/addgene:70172 ; RRID:Addgene_70172)
  • For your References section:

    Transcription yield of fully 2'-modified RNA can be increased by the addition of thermostabilizing mutations to T7 RNA polymerase mutants. Meyer AJ, Garry DJ, Hall B, Byrom MM, McDonald HG, Yang X, Yin YW, Ellington AD. Nucleic Acids Res. 2015 Sep 3;43(15):7480-8. doi: 10.1093/nar/gkv734. Epub 2015 Jul 24. 10.1093/nar/gkv734 PubMed 26209133