p6XHis-T7(P266L)
(Plasmid #174866)

• Purpose: Expresses a T7 RNA Polymerase that produces long RNA transcripts in high yield and generates fewer abortive transcripts.
• Depositing Lab: Anna Pyle
• Publication: Chillon et al Methods Enzymol. 2015;558:3-37. doi: 10.1016/bs.mie.2015.01.008. Epub 2015 Feb 27.

Backbone

• Vector backbone: pBR322
• Backbone size w/o insert (bp): 2706
• Total vector size (bp): 5427
• Modifications to backbone: Upstream lac promoter and operator are added as well as RBS
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Use BL21(DE3) for protein expression
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: T7 RNA polymerase
• Species: T7 bacteriophage
• Insert Size (bp): 2721
• Mutation: P266L
• Promoter: lac promoter
• Tag / Fusion Protein:
  • 6XHis-tag (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CAGGAAACAGCTATGACCATG
• 3′ sequencing primer: CGTTCTCGGAGCACTGTCCG

Resource Information

• Supplemental Documents:
  • Protocol of T7 RNA polymerase expression and purification

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

An earlier reference about P266L :
A mutation in T7 RNA polymerase that facilitates promoter clearance (PMID: 15831591)