Skip to main content

pAAV EF1a DIO iChloC 2A dsRed
(Plasmid #70762)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 70762 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5601
  • Total vector size (bp) 8007
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Channelrhodopsin-2
  • Alt name
    ChR2, iChloC
  • Species
    Synthetic; Chlamydomonas
  • Insert Size (bp)
    927
  • Mutation
    E83Q,E90R,E101S,D156N,T159C
  • Promoter EF1a

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GGGATTCTCCTCCACGTCACCGC
  • 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
    dsRed
  • Species
    Discoma sp.
  • Promoter EF1a

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gagtttggatcttggttc
  • 3′ sequencing primer GGCAGAGGAAGTCTTCTAACAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ChR originally from P.Hegemann, HU-Berlin Germany tDimer originally form R.Tsien USD USA
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV EF1a DIO iChloC 2A dsRed was a gift from Thomas Oertner (Addgene plasmid # 70762 ; http://n2t.net/addgene:70762 ; RRID:Addgene_70762)
  • For your References section:

    An improved chloride-conducting channelrhodopsin for light-induced inhibition of neuronal activity in vivo. Wietek J, Beltramo R, Scanziani M, Hegemann P, Oertner TG, Simon Wiegert J. Sci Rep. 2015 Oct 7;5:14807. doi: 10.1038/srep14807. 10.1038/srep14807 PubMed 26443033