This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24th & 25th and December 31st & January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV EF1a DIO iChloC 2A dsRed
(Plasmid #70762)


Item Catalog # Description Quantity Price (USD)
Plasmid 70762 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5601
  • Total vector size (bp) 8007
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Alt name
    ChR2, iChloC
  • Species
    Synthetic; Chlamydomonas
  • Insert Size (bp)
  • Mutation
  • Promoter EF1a

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GGGATTCTCCTCCACGTCACCGC
  • 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
  • Species
    Discoma sp.
  • Promoter EF1a

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gagtttggatcttggttc
  • 3′ sequencing primer GGCAGAGGAAGTCTTCTAACAT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV EF1a DIO iChloC 2A dsRed was a gift from Thomas Oertner (Addgene plasmid # 70762 ; ; RRID:Addgene_70762)