-
PurposeSS9-targeting gRNA for co-transformation with pSS9
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 2564
- Total vector size (bp) 2584
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSS9 gRNA
-
gRNA/shRNA sequencetctggcgcagttgatatgta
-
SpeciesEscherichia coli
- Promoter J23119
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ataagggcgacacggaaatgttgaatactc
- 3′ sequencing primer tttatttgatgcctggcagttccctactctcgcatgg (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SS9_RNA was a gift from Ryan Gill (Addgene plasmid # 71656 ; http://n2t.net/addgene:71656 ; RRID:Addgene_71656) -
For your References section:
Rapid and Efficient One-Step Metabolic Pathway Integration in E. coli. Bassalo MC, Garst AD, Halweg-Edwards AL, Grau WC, Domaille DW, Mutalik VK, Arkin AP, Gill RT. ACS Synth Biol. 2016 Apr 22. 10.1021/acssynbio.5b00187 PubMed 27072506