-
PurposeExpresses two gRNAs targeting MALAT1 promoter
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72622 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLentiguide-puro
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNAs toward Malat1
-
gRNA/shRNA sequencegRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2:AGGTTTCTAAAACATGACGG
-
SpeciesH. sapiens (human)
- Promoter U6 (gRNA1) and H1 (gRNA2)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
- 3′ sequencing primer hGata4-rev (5'-ATTGTGGATGAATACTGCC-3') (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDECKO_Malat1_C was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 72622 ; http://n2t.net/addgene:72622 ; RRID:Addgene_72622) -
For your References section:
DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. Aparicio-Prat E, Arnan C, Sala I, Bosch N, Guigo R, Johnson R. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. 10.1186/s12864-015-2086-z [pii] PubMed 26493208