This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pNICKclos2.0
(Plasmid #73228)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73228 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pXY1
  • Vector type
    E.coli - clostridium shuttle vector
  • Selectable markers
    Erythromycin in clostridium

Growth in Bacteria

  • Bacterial Resistance(s)
    low Amp
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9 nickase
  • Species
    S. pyogenes MGAS5005
  • Mutation
    D10A
  • Promoter Pthl

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer SpCas9N-R TACGAGCTGTCCGTTTGAGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    sgRNA to xylR
  • Species
    Synthetic
  • Promoter Pj23119

Cloning Information for Gene/Insert 2

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNICKclos2.0 was a gift from Sheng Yang (Addgene plasmid # 73228)
  • For your References section:

    CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Li Q, Chen J, Minton NP, Zhang Y, Wen Z, Liu J, Yang H, Zeng Z, Ren X, Yang J, Gu Y, Jiang W, Jiang Y, Yang S. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053. 10.1002/biot.201600053 PubMed 27213844