Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV Synapsin Intron H2B Gcamp 6s wpre Pzac2.1
(Plasmid #74150)


Item Catalog # Description Quantity Price (USD)
Plasmid 74150 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    AAV synapsin intron
  • Backbone size w/o insert (bp) 4821
  • Total vector size (bp) 6579
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
  • Species
    R. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
  • Insert Size (bp)
  • Promoter Synapsin
  • Tag / Fusion Protein
    • H2B (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NruI (destroyed during cloning)
  • 3′ cloning site NruI (destroyed during cloning)
  • 5′ sequencing primer Intron f; gtatcaaggttacaagacag
  • 3′ sequencing primer AAV1621 r; gagttgtggcccgttgtcag
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Vector: AA0215 AAV Synapsin intron Pzac2.1

from Scott sternson lab hhmi/Jfrc

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV Synapsin Intron H2B Gcamp 6s wpre Pzac2.1 was a gift from Loren Looger (Addgene plasmid # 74150 ; ; RRID:Addgene_74150)