Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV Cag Flex H2B Gcamp6f reverse
(Plasmid #74155)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74155 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV CAG Flex
  • Backbone size w/o insert (bp) 5009
  • Total vector size (bp) 6771
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Gcamp6f
  • Alt name
    GCaMP3-T302L R303P A317E D380Y T381R S383T R392G
  • Species
    R. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
  • Insert Size (bp)
    1353
  • Promoter CAG
  • Tag / Fusion Protein
    • H2B (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (destroyed during cloning)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer AAV 1145f: caaggctttcacgcagccacag
  • 3′ sequencing primer AAV 1621r : ctgacaacgggccacaactc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV Cag Flex H2B Gcamp6f reverse was a gift from Loren Looger (Addgene plasmid # 74155 ; http://n2t.net/addgene:74155 ; RRID:Addgene_74155)