pMX-HA-UbvG08-IRES-GFP
(Plasmid
#75030)
-
PurposeRetroviral vector with ubiquitin variant that binds to and occludes the ligand binding site of the 53BP1 Tudor domain (i53)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75030 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMX-IRES-GFP
-
Backbone manufacturerCell Biolabs, Inc.
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 6184
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUbiquitin
-
Alt namesynthetic engineered ubiquitin variant UbvG08 (i53)
-
Alt namepMX-HA-i53-IRES-GFP
-
SpeciesSynthetic
-
MutationUbvG08 with I44A mutation and no terminal Glycines
-
Tags
/ Fusion Proteins
- HA (N terminal on insert)
- IRES-eGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site PacI (unknown if destroyed)
- 5′ sequencing primer GACGGCATCGCAGCTTGGATACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
bioRxiv (10.1101/060954)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMX-HA-UbvG08-IRES-GFP was a gift from Daniel Durocher (Addgene plasmid # 75030 ; http://n2t.net/addgene:75030 ; RRID:Addgene_75030) -
For your References section:
Inhibition of 53BP1 favors homology-dependent DNA repair and increases CRISPR-Cas9 genome-editing efficiency. Canny MD, Moatti N, Wan LCK, Fradet-Turcotte A, Krasner D, Mateos-Gomez PA, Zimmermann M, Orthwein A, Juang YC, Zhang W, Noordermeer SM, Seclen E, Wilson MD, Vorobyov A, Munro M, Ernst A, Ng TF, Cho T, Cannon PM, Sidhu SS, Sicheri F, Durocher D. Nat Biotechnol. 2018 Jan;36(1):95-102. doi: 10.1038/nbt.4021. Epub 2017 Nov 27. 10.1038/nbt.4021 PubMed 29176614