pMX-HA-UbvG08_MUT-IRES-GFP
(Plasmid
#75031)
-
PurposeRetroviral vector with ubiquitin variant with reverted mutations L69P and V70L (i53-DM mutant)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 75031 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMX-IRES-GFP
-
Backbone manufacturerCell Biolabs, Inc.
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 6184
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUbiquitin
-
Alt namesynthetic engineered ubiquitin variant UbvG08 (i53 DM - mutant)
-
Alt namepMX-HA-i53-DM-IRES-GFP
-
SpeciesSynthetic
-
Insert Size (bp)284
-
MutationUbvG08 with I44A, P69L, and L70V mutations and no terminal Glycines
-
Tags
/ Fusion Proteins
- HA (N terminal on insert)
- IRES-eGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site PacI (unknown if destroyed)
- 5′ sequencing primer GACGGCATCGCAGCTTGGATACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
bioRxiv (10.1101/060954)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMX-HA-UbvG08_MUT-IRES-GFP was a gift from Daniel Durocher (Addgene plasmid # 75031 ; http://n2t.net/addgene:75031 ; RRID:Addgene_75031) -
For your References section:
Inhibition of 53BP1 favors homology-dependent DNA repair and increases CRISPR-Cas9 genome-editing efficiency. Canny MD, Moatti N, Wan LCK, Fradet-Turcotte A, Krasner D, Mateos-Gomez PA, Zimmermann M, Orthwein A, Juang YC, Zhang W, Noordermeer SM, Seclen E, Wilson MD, Vorobyov A, Munro M, Ernst A, Ng TF, Cho T, Cannon PM, Sidhu SS, Sicheri F, Durocher D. Nat Biotechnol. 2018 Jan;36(1):95-102. doi: 10.1038/nbt.4021. Epub 2017 Nov 27. 10.1038/nbt.4021 PubMed 29176614