Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #75030)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 75030 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Cell Biolabs, Inc.
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 6184
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
    synthetic engineered ubiquitin variant UbvG08 (i53)
  • Alt name
  • Species
  • Mutation
    UbvG08 with I44A mutation and no terminal Glycines
  • Tags / Fusion Proteins
    • HA (N terminal on insert)
    • IRES-eGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site PacI (unknown if destroyed)
  • 5′ sequencing primer GACGGCATCGCAGCTTGGATACAC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

bioRxiv (10.1101/060954)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMX-HA-UbvG08-IRES-GFP was a gift from Daniel Durocher (Addgene plasmid # 75030 ; ; RRID:Addgene_75030)
  • For your References section:

    Inhibition of 53BP1 favors homology-dependent DNA repair and increases CRISPR-Cas9 genome-editing efficiency. Canny MD, Moatti N, Wan LCK, Fradet-Turcotte A, Krasner D, Mateos-Gomez PA, Zimmermann M, Orthwein A, Juang YC, Zhang W, Noordermeer SM, Seclen E, Wilson MD, Vorobyov A, Munro M, Ernst A, Ng TF, Cho T, Cannon PM, Sidhu SS, Sicheri F, Durocher D. Nat Biotechnol. 2018 Jan;36(1):95-102. doi: 10.1038/nbt.4021. Epub 2017 Nov 27. 10.1038/nbt.4021 PubMed 29176614