Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

psiCHECK2-miR-34 MT
(Plasmid #78259)


Item Catalog # Description Quantity Price (USD)
Plasmid 78259 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6273
  • Total vector size (bp) 6302
  • Vector type
    Mammalian Expression, Luciferase ; microRNA activity

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    mutated miR-34 target site
  • Species
  • Insert Size (bp)
  • Mutation
    nucleotides 2-5 and 10-11 changed from CCGT to GGCA and GA to CT, respectively

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGTGCTGAAGAACGAGCAGT
  • 3′ sequencing primer CAAACCCCCGCCTCCACGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK2-miR-34 MT was a gift from Joanne Weidhaas (Addgene plasmid # 78259 ; ; RRID:Addgene_78259)
  • For your References section:

    miR-34 activity is modulated through 5'-end phosphorylation in response to DNA damage. Salzman DW, Nakamura K, Nallur S, Dookwah MT, Metheetrairut C, Slack FJ, Weidhaas JB. Nat Commun. 2016 Mar 21;7:10954. doi: 10.1038/ncomms10954. 10.1038/ncomms10954 PubMed 26996824