This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBABEpuro mTurquoise2 LC3B
(Plasmid #78518)


Item Catalog # Description Quantity Price (USD)
Plasmid 78518 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pBABE puro
  • Backbone size w/o insert (bp) 5153
  • Total vector size (bp) 6272
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter retroviral
  • Tag / Fusion Protein
    • mTurquoise2 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 3′ sequencing primer CCTGGGGACTTTCCACACCCTAAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBABEpuro mTurquoise2 LC3B was a gift from David Chan (Addgene plasmid # 78518 ; ; RRID:Addgene_78518)
  • For your References section:

    Elimination of paternal mitochondria in mouse embryos occurs through autophagic degradation dependent on PARKIN and MUL1. Rojansky R, Cha MY, Chan DC. Elife. 2016 Nov 17;5. pii: e17896. doi: 10.7554/eLife.17896. 10.7554/eLife.17896 PubMed 27852436