Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #78548)


Item Catalog # Description Quantity Price (USD)
Plasmid 78548 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Addgene 52962
  • Backbone size w/o insert (bp) 12859
  • Total vector size (bp) 13669
  • Modifications to backbone
    Added T2A-GFP
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Insert Size (bp)
  • Promoter In frame with Cas9

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer Gacgctgtagtcttcagagatg
  • 3′ sequencing primer CGAAGGACCGCGCACCTGGT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Note: Compared to the provided full plasmid sequence, Addgene's quality control sequencing finds a G202S amino acid residue substitution in the EGFP fluorophore. The depositing laboratory is aware of this residue change, and it does not affect fluorophore function.

Note that, according to the depositing laboratory, this plasmid results in a weak GFP signal that may be difficult to see by microscope, but it is useful for flow cytometry.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCas9-T2A-GFP was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 78548 ; ; RRID:Addgene_78548)
  • For your References section:

    Scalable Design of Paired CRISPR Guide RNAs for Genomic Deletion. Pulido-Quetglas C, Aparicio-Prat E, Arnan C, Polidori T, Hermoso T, Palumbo E, Ponomarenko J, Guigo R, Johnson R. PLoS Comput Biol. 2017 Mar 2;13(3):e1005341. doi: 10.1371/journal.pcbi.1005341. eCollection 2017 Mar. PCOMPBIOL-D-16-01254 [pii] PubMed 28253259