pET11a-CA(A14C, E45C)
(Plasmid
#79045)
-
PurposeBacterial vector for cloning and propagation in DH5alpha
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79045 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET11a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5677
- Total vector size (bp) 6340
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCA (A14C, E45C)
-
SpeciesLentivirus HIV-1
-
Insert Size (bp)699
-
MutationA14C and E45C mutations in HIV-1 CA protein
-
GenBank IDAF324493.2
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TATGCTAGTTATTGCTCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypET11a-CA(A14C, E45C) was provided by Dr. Owen Pornillos
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET11a-CA(A14C, E45C) was a gift from Wesley Sundquist (Addgene plasmid # 79045 ; http://n2t.net/addgene:79045 ; RRID:Addgene_79045) -
For your References section:
Primate TRIM5 proteins form hexagonal nets on HIV-1 capsids. Li YL, Chandrasekaran V, Carter SD, Woodward CL, Christensen DE, Dryden KA, Pornillos O, Yeager M, Ganser-Pornillos BK, Jensen GJ, Sundquist WI. Elife. 2016 Jun 2;5. pii: e16269. doi: 10.7554/eLife.16269. 10.7554/eLife.16269 PubMed 27253068