Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSLQ2817 pPB: CAG-PYL1-VPR-IRES-Puro-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9
(Plasmid #84239)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84239 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PB
  • Backbone manufacturer
    System Biosciences
  • Total vector size (bp) 15416
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology ; PiggyBac
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ABI-tagBFP-Sp dCas9
  • Species
    A. thaliana (mustard weed), Synthetic; S. pyogenes
  • Insert Size (bp)
    5880
  • Promoter PGK
  • Tags / Fusion Proteins
    • ABI (N terminal on insert)
    • tagBFP (N terminal on insert)
    • HA tag (C terminal on insert)
    • 2xNLS (SV40) (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gaaggtcctccggaggcc
  • 3′ sequencing primer CGGTCTGTATATCGAGGTTTATTTATTAATTTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PYL1-VPR
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    2145
  • Promoter CAG
  • Tags / Fusion Proteins
    • PYL1 (N terminal on insert)
    • IRES-Puro (C terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tcggcttctggcgtgtga
  • 3′ sequencing primer gacggcaatatggtggaaaataac
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The dCas9 gene was a gift from Martin Jinek and Jennifer Doudna (UC Berkeley). The ABI and PYL1 domains were gifts from Jerry Crabtree (Stanford)
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ2817 pPB: CAG-PYL1-VPR-IRES-Puro-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9 was a gift from Stanley Qi (Addgene plasmid # 84239 ; http://n2t.net/addgene:84239 ; RRID:Addgene_84239)
  • For your References section:

    Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Gao Y, Xiong X, Wong S, Charles EJ, Lim WA, Qi LS. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. 10.1038/nmeth.4042 PubMed 27776111