Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEpic
(Plasmid #84372)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84372 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti PGK PURO DEST (Addgene 19068)
  • Backbone size (bp) 9093
  • Modifications to backbone
    pEpic was made by blunt-end cloning the XhoI/ClaI-defined attR4-attR3 cassette from pDestTol2pA2 into the 7.3kb EcoRV fragment of pLenti PGK PURO DEST, effectively replacing its attR1-attR2 cassette.
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    May take up to 48 hr for single colonies to form on plates.
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pTYF-5 (GTAGACATAATAGCAACAGAC)
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEpic was a gift from Kryn Stankunas (Addgene plasmid # 84372 ; http://n2t.net/addgene:84372 ; RRID:Addgene_84372)
  • For your References section:

    A MultiSite Gateway Toolkit for Rapid Cloning of Vertebrate Expression Constructs with Diverse Research Applications. Fowler DK, Stewart S, Seredick S, Eisen JS, Stankunas K, Washbourne P. PLoS One. 2016 Aug 8;11(8):e0159277. doi: 10.1371/journal.pone.0159277. eCollection 2016. PONE-D-16-19476 [pii] PubMed 27500400