1
Plasmid 8457: Twist-siRNA7
  • siTwist

  • siRNA Twist

  • mTwist

  • Twist

  • M. musculus (mouse)

  • M63649

  • Twist1 (AA960487, M-Twist, Pde, Ska10, Ska<m10Jus>, Twist, bHLHa38, pdt)

  • pSP-108
    (Search Vector Database)

  • Mammalian Expression

  • 9439

  • BstBI

  • No

  • BamHI

  • No

  • na List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • Puromycin

  • Empty pSP108 vector can be obtained from Dr. Eric Fearson, Univ of Michigan

  • View map

  • Bob Weinberg

  • MTA

Comments: 

Twist-siRNA7-targetting sequence is AGCGGGTCATGGCTAACGTGC

This plasmid has not been sequence verified. If you would like Addgene to sequence a portion of this plasmid before you request it, please contact us.

Article: Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Yang et al (Cell 2004 Jun 25;117(7):927-39. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 8457" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only