This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #85468)


Item Catalog # Description Quantity Price (USD)
Plasmid 85468 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3152
  • Total vector size (bp) 4202
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Bacterial Photoactivated Adenylyl Cyclase
  • Alt name
  • Species
    Synthetic; Beggiatoa sp.
  • Insert Size (bp)
  • GenBank ID
  • Promoter T7 promoter
  • Tags / Fusion Proteins
    • Myc (C terminal on insert)
    • His (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BsiWI (unknown if destroyed)
  • 5′ sequencing primer T7 forward
  • 3′ sequencing primer Seq12rv: GTGTAAGTTGGTATTATGTAG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    bPAC-mycHis_pGEM was a gift from Peter Hegemann (Addgene plasmid # 85468 ; ; RRID:Addgene_85468)
  • For your References section:

    Light modulation of cellular cAMP by a small bacterial photoactivated adenylyl cyclase, bPAC, of the soil bacterium Beggiatoa. Stierl M, Stumpf P, Udwari D, Gueta R, Hagedorn R, Losi A, Gartner W, Petereit L, Efetova M, Schwarzel M, Oertner TG, Nagel G, Hegemann P. J Biol Chem. 2011 Jan 14. 286(2):1181-8. 10.1074/jbc.M110.185496 PubMed 21030594