Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

hSyn ArcLightCo (Q239)-T2A-nls-mCherry
(Plasmid #85844)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85844 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCS2+ hSyn1
  • Backbone size w/o insert (bp) 4372
  • Total vector size (bp) 5833
  • Modifications to backbone
    a hygromysin resistance gene was inserted to facilitate selection for stably transfected cells.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ArcLightCo-Q239
  • Alt name
    ArcLight
  • Alt name
    CiVSP
  • Alt name
    Super Ecliptic pHluorin
  • Species
    Ciona intestinalis
  • Insert Size (bp)
    1461
  • Mutation
    Ci-VSP contains R217Q mutation; super ecliptic pHluorin contains A227D mutation. The A227D mutation increases the fluorescence response magnitude. We replaced residues 71-91 within CiVSD with an amino acid sequence (KSRITSEGEYIPLDQIDINV) from the Kir2.1 channel Golgi-to-plasma membrane trafficking signal. The Kir 2.1 channel ER export signal sequence (FCYENEV) was added to C-terminus of super ecliptic pHluorin. The sequence is codon optimized using mammalian codon preference.
  • GenBank ID
    AB183035 AY533296
  • Promoter hSyn1
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SphI (not destroyed)
  • 5′ sequencing primer AGTCGTGTCGTGCCTGAGAG
  • 3′ sequencing primer ccttgagcatctgacttctggcta
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

A portion of this plasmid was derived from a plasmid made by Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hSyn ArcLightCo (Q239)-T2A-nls-mCherry was a gift from Vincent Pieribone (Addgene plasmid # 85844 ; http://n2t.net/addgene:85844 ; RRID:Addgene_85844)
  • For your References section:

    Directed evolution of key residues in fluorescent protein inverses the polarity of voltage sensitivity in the genetically-encoded indicator ArcLight. Platisa J, Vasan G, Yang A, Pieribone VA. ACS Chem Neurosci. 2017 Jan 3. doi: 10.1021/acschemneuro.6b00234. 10.1021/acschemneuro.6b00234 PubMed 28045247