This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #86128)


Item Catalog # Description Quantity Price (USD)
Plasmid 86128 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pLentiCRISPR v1
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    sgRNA 1 targeting SHOC2
  • gRNA/shRNA sequence
  • Entrez Gene
    SHOC2 (a.k.a. SIAA0862, SOC2, SUR8)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer CCCAGAGAGGGCCTATTTCCCA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPR-sgSHOC2-1 was a gift from David Sabatini (Addgene plasmid # 86128 ; ; RRID:Addgene_86128)
  • For your References section:

    Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Wang T, Yu H, Hughes NW, Liu B, Kendirli A, Klein K, Chen WW, Lander ES, Sabatini DM. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. 10.1016/j.cell.2017.01.013 PubMed 28162770