Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pX335 HTT sgRNA-a
(Plasmid #87201)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87201 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX335 (Addgene #42335)
  • Total vector size (bp) 8437
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HTT
  • gRNA/shRNA sequence
    GACCCTGGAAAAGCTGATGA
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning) (unknown if destroyed)
  • 3′ cloning site BbsI (destroyed during cloning) (unknown if destroyed)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX335 HTT sgRNA-a was a gift from Mahmoud Pouladi (Addgene plasmid # 87201 ; http://n2t.net/addgene:87201 ; RRID:Addgene_87201)
  • For your References section:

    Reversal of Phenotypic Abnormalities by CRISPR/Cas9-Mediated Gene Correction in Huntington Disease Patient-Derived Induced Pluripotent Stem Cells. Xu X, Tay Y, Sim B, Yoon SI, Huang Y, Ooi J, Utami KH, Ziaei A, Ng B, Radulescu C, Low D, Ng AY, Loh M, Venkatesh B, Ginhoux F, Augustine GJ, Pouladi MA. Stem Cell Reports. 2017 Feb 21. pii: S2213-6711(17)30038-3. doi: 10.1016/j.stemcr.2017.01.022. 10.1016/j.stemcr.2017.01.022 PubMed 28238795