PI(DM)-Rac1(WT)dc1.FLARE
(Plasmid
#87589)
-
PurposePI(DM): Photo-inhibitable/dark mutant C450A; dc1.FLARE: built based on GTPase FLARE dual chain sensor
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 87589 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTriEx
- Backbone size w/o insert (bp) 5238
- Total vector size (bp) 7228
-
Vector typeMammalian Expression, Bacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLOV2
-
SpeciesSynthetic
-
Insert Size (bp)447
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer aagtatcgggccctttgtgc
- 3′ sequencing primer GGCAGCCTGCACCTGAGGTTAATCAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePBD
- Promoter CMV
-
Tag
/ Fusion Protein
- YPet
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer aagtatcgggccctttgtgc
- 3′ sequencing primer GGCAGCCTGCACCTGAGGTTAATCAC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameRac1
- Promoter CMV
-
Tag
/ Fusion Protein
- dTurq
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer TCGATCTCAGTGGTATTTGTG
- 3′ sequencing primer AAGTTCTTTTGCCGCCTCATC (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PI(DM)-Rac1(WT)dc1.FLARE was a gift from Klaus Hahn (Addgene plasmid # 87589 ; http://n2t.net/addgene:87589 ; RRID:Addgene_87589) -
For your References section:
Engineering extrinsic disorder to control protein activity in living cells. Dagliyan O, Tarnawski M, Chu PH, Shirvanyants D, Schlichting I, Dokholyan NV, Hahn KM. Science. 2016 Dec 16;354(6318):1441-1444. 10.1126/science.aah3404 PubMed 27980211