pKS7107
(Plasmid
#89051)
-
PurposeExpresses Nm crRNA, Nm tracrRNA and human codon-optimized NmCas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89051 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSimpleII
- Backbone size w/o insert (bp) 3756
- Total vector size (bp) 9305
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameNm crRNA
-
Alt nameNeisseria meningitidis CRISPR RNA
-
Insert Size (bp)51
- Promoter human U6
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer AAAACAGGAAGGCAAAATGC
- 3′ sequencing primer gggagatctcccgatccgtc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNm tracrRNA
-
Alt nameNeisseria meningitidis tracrRNA
-
Insert Size (bp)105
- Promoter human U6
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer AAAACAGGAAGGCAAAATGC
- 3′ sequencing primer gggagatctcccgatccgtc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namehNmCas9
-
Alt namehuman codon-optimized Neisseria meningitidis Cas9 nuclease
- Promoter EF1a
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- HA tag (C terminal on insert)
- NLS (C terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer gactgaagttaggccagc
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKS7107 was a gift from Ervin Welker (Addgene plasmid # 89051 ; http://n2t.net/addgene:89051 ; RRID:Addgene_89051) -
For your References section:
Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Toth E, Weinhardt N, Bencsura P, Huszar K, Kulcsar PI, Talas A, Fodor E, Welker E. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. 10.1186/s13062-016-0147-0 [pii] PubMed 27630115