Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKS7107
(Plasmid #89051)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89051 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSimpleII
  • Backbone size w/o insert (bp) 3756
  • Total vector size (bp) 9305
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Nm crRNA
  • Alt name
    Neisseria meningitidis CRISPR RNA
  • Insert Size (bp)
    51
  • Promoter human U6

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer AAAACAGGAAGGCAAAATGC
  • 3′ sequencing primer gggagatctcccgatccgtc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Nm tracrRNA
  • Alt name
    Neisseria meningitidis tracrRNA
  • Insert Size (bp)
    105
  • Promoter human U6

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer AAAACAGGAAGGCAAAATGC
  • 3′ sequencing primer gggagatctcccgatccgtc
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    hNmCas9
  • Alt name
    human codon-optimized Neisseria meningitidis Cas9 nuclease
  • Promoter EF1a
  • Tags / Fusion Proteins
    • SV40 NLS (N terminal on insert)
    • HA tag (C terminal on insert)
    • NLS (C terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer gactgaagttaggccagc
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKS7107 was a gift from Ervin Welker (Addgene plasmid # 89051 ; http://n2t.net/addgene:89051 ; RRID:Addgene_89051)
  • For your References section:

    Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Toth E, Weinhardt N, Bencsura P, Huszar K, Kulcsar PI, Talas A, Fodor E, Welker E. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. 10.1186/s13062-016-0147-0 [pii] PubMed 27630115