BRCA2 A11.2 gRNA
(Plasmid
#90550)
-
Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 90550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti-sgRNA
-
Backbone manufacturerEric Lander & David Sabatini labs (Addgene plasmid #71409)
- Backbone size w/o insert (bp) 9151
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBRCA2 (Guide Designation A11.2)
-
Alt namepKMKO series
-
gRNA/shRNA sequenceCACCGAAACCATCTTATAATCAGC
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
- 3′ sequencing primer EF1a-R (5'-CACGGCGACTACTGCACTTA-3') (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
Depositor Comments
Please note that gRNA target sequence listed is not strictly the 20nt spacer sequence, but also contains the 5' BsmBI overhang. For more information about knockout human cell lines generated using this plasmid, please see http://cellcycleknockouts.wi.mit.edu/ .
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BRCA2 A11.2 gRNA was a gift from Iain Cheeseman (Addgene plasmid # 90550 ; http://n2t.net/addgene:90550 ; RRID:Addgene_90550) -
For your References section:
Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. McKinley KL, Cheeseman IM. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16. 10.1016/j.devcel.2017.01.012 PubMed 28216383