pDD121
(Plasmid
#91833)
-
PurposeCas9 expression in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91833 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCFJ601
-
Backbone manufacturerErik Jorgensen lab (Addgene #24874)
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesSynthetic
-
Insert Size (bp)4323
-
MutationCodon optimized and with synthetic introns for C. elegans
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAGTTGGGAAACACTTTGCT
- 3′ sequencing primer gcttgaaaggattttgcatttatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Same Cas9 expression cassette present in the widely-used pDD162, but does not have an sgRNA expression cassette.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDD121 was a gift from Bob Goldstein (Addgene plasmid # 91833 ; http://n2t.net/addgene:91833 ; RRID:Addgene_91833) -
For your References section:
SapTrap assembly of repair templates for Cas9-triggered homologous recombination with a self-excising cassette. Dickinson D, Slabodnick M, Chen A, Goldstein B. MicroPubl Biol. 2018 May 1;2018:10.17912/W2KT0N. doi: 10.17912/W2KT0N. 10.17912/W2KT0N PubMed 32550377