Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #91948)


Item Catalog # Description Quantity Price (USD)
Plasmid 91948 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    F. Zhang Lab (Addgene #60229)
  • Backbone size w/o insert (bp) 6394
  • Total vector size (bp) 5956
  • Modifications to backbone
    1. The Cre gene in the backbone plasmid was replaced by the mCherry gene at the restriction sites AgeI and EcoRI. The mCherry DNA was PCR-amplified from the plasmid pAAV-CaMKIIa-hChR2(E123T/T159C)-mCherry (Addgene #35512). 2. The 17-bp scrambled gRNA sequence between the U6 promoter and gRNA scaffolding sequence in the control plasmid was replaced by 19-bp CB2R gRNA sequence, which targets the early part of CB2R coding sequence (26th–44th bp of 1044 bp). gRNA sequence: 5' GTGACCAACGGCTCCAACGG 3'
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
  • Insert Size (bp)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-U6-CB2gRNA-CBh-mCherry was a gift from Jimok Kim (Addgene plasmid # 91948 ; ; RRID:Addgene_91948)
  • For your References section:

    Distinct roles of neuronal and microglial CB2 cannabinoid receptors in the mouse hippocampus. Li Y, Kim J. Neuroscience. 2017 Sep 6. pii: S0306-4522(17)30629-2. doi: 10.1016/j.neuroscience.2017.08.053. 10.1016/j.neuroscience.2017.08.053 PubMed 28888955