Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #98744)


Item Catalog # Description Quantity Price (USD)
Plasmid 98744 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4300
  • Total vector size (bp) 13000
  • Modifications to backbone
    Additional Leu marker, additional integration cassette for the ura3-52 locus
  • Vector type
    Yeast Expression, Synthetic Biology
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Gene/Insert 1

  • Gene/Insert name
    phytochrome interacting factor 3
  • Alt name
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    PIF3 (a.k.a. AT1G09530, F14J9.19, F14J9_19, PAP3, PHOTOCURRENT 1, PHYTOCHROME INTERACTING FACTOR 3, PHYTOCHROME-ASSOCIATED PROTEIN 3, POC1, phytochrome interacting factor 3, purple acid phosphatase 3)
  • Promoter FBA1
  • Tags / Fusion Proteins
    • SV40-NLS (C terminal on insert)
    • VP64-AD (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTCCTTCTTCTTCGCCCA
  • 3′ sequencing primer AAGAAAAGAGCCGACCAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    phytochrome B
  • Alt name
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
  • Mutation
    mutated nucleotide 576 C to A, deleted amino acids 622-1172
  • GenBank ID
  • Entrez Gene
    PHYB (a.k.a. AT2G18790, HY3, MSF3.17, MSF3_17, OOP1, OUT OF PHASE 1, PHYTOCHROME B, phytochrome B)
  • Promoter TDH3
  • Tag / Fusion Protein
    • synTALE-DBD (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAATAGCGCATCAAGAAAA
  • 3′ sequencing primer CCCTGAAATTATTCCCCTAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRL_CT_GI_del1 was a gift from Bernd Müller-Röber (Addgene plasmid # 98744 ; ; RRID:Addgene_98744)
  • For your References section:

    PhiReX: a programmable and red light-regulated protein expression switch for yeast. Hochrein, Lena , Fabian Machens, Katrin Messerschmidt, Bernd Mueller-Roeber. Nucleic Acids Research, /10.1093/nar/gkx610