Skip to main content
Addgene

Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease.

Gratz SJ, Cummings AM, Nguyen JN, Hamm DC, Donohue LK, Harrison MM, Wildonger J, O'Connor-Giles KM
Genetics. 2013 May 24. (Link opens in a new window) PubMed (Link opens in a new window) Article

Harrison Lab - Wildonger Lab - O'Connor-Giles Lab email: [email protected]

We have found that a variety of Cas9-mediated genome modifications can be efficiently generated in Drosophila and transmitted through the germline. Using an injection approach, stable lines with targeted genome alterations can be generated within a month. phsp70-Cas9 and a single chiRNA plasmid can be coinjected to generate mutations via imperfectly repaired DSBs. Coinjection of phsp70-Cas9 and plasmids encoding two chiRNAs can induce defined deletions between the two cleavage sites, while the addition of an ssODN donor template can mediate gene replacement by homologous recombination.

For the sgRNA, vector pMB60 allows in vitro production of RNA from the T7 promoter, while pMB70 is designed for in vivo transcription controlled by the regulatory sequences of an RNA polymerase III transcribed U6 snRNA. In both vectors, the target site sequence can be added by inserting an oligonucleotide linker into BsaI digested vector.

Cloning targeting chiRNAs

Targeting chiRNAs are easily cloned by annealed oligos into the pU6-BbsI-chiRNA plasmid via the BbsI restriction sites.

The sense oligo is 5’ CTTCG and 19 nucleotides 3’. Below is the antisense oligo: 3’ C (lined up with the G above), 19 nucleotides, and CAAA 5’.
Figure 1: The template for oligo design.

The genomic sequence is 5’ GATTACCGCTATCAGGTACCTGG 3’. Below is the sense and antisense oligos. The sense oligo is 5’ CTTC overhang, G (lined up below the first G of the genomic sequence), ATTACCGCTATCAGGTACC 3’. The antisense oligo is 3’ C (lined up below the above G’s), TAATGGCGATAGTCCATGG and CAAA 5’ overhang. The Cas9 cut site is before the last 6 nt (5’ ACCTGG 3’) of the genomic sequence.

Figure 2: Example oligo design.

In Figure 2, the overhang sequences of 5’ CTTC 3’ (sense oligo) and 3’ CAAA 5’ (antisense oligo) are complementary to the BbsI cut site. The G in the sense oligo corresponds to the first nucleotide (nt) of the chiRNA and is necessary for efficient U6-driven expression. This G is the first nt in the 20 nt targeting sequence. The sense oligo 19 nt sequence is the exact same sequence as the genomic target sequence. Do not include the 3 nt NGG PAM sequence. The red arrowhead indicates the Cas9 cut site.

Resources

flyCRISPR Plasmids

ID Plasmid
46294 pBS-Hsp70-Cas9: A codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter.
45945 pHsp70-Cas9: The codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter used in Gratz, et al. (2013). Plasmid is low copy number.
45946 pU6-BbsI-chiRNA: Plasmid for expression of chiRNA under the control of the Drosophila snRNA:U6:96Ab promoter.
51019 pDsRed-attP: Vector for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site. Contains the visible marker 3xP3-DsRed. (Also known as pHD-DsRed-att).
51026 U6-BbsI-crRNA: Generates crRNA for use in combination with tracrRNA.
51434 pHD-DsRed: vector for generating dsDNA donors for homology-directed repair. Contains the visible marker 3xP3-DsRed.

Plasmids from Article

ID Plasmid Purpose
45945pHsp70-Cas9The codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter used in Gratz, et al. (2013). Plasmid is low copy number.
45946pU6-BbsI-chiRNAPlasmid for expression of chiRNA under the control of the Drosophila snRNA:U6:96Ab promoter.

Antibodies from Article