Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
218442 gWiz_BM40-vMAT2-VH-hIgG1-CH1-TS-HIS vMAT2-Vh-hIgG1-CH4 (Synthetic) Brunger Apr 25, 2024
218443 gWiz_BM40-vMAT2-VL-hIgG1-CL vMAT2-VL-hIgG1-CL (Synthetic) Brunger Apr 25, 2024
218519 pUCIDT-AMP-Fp16SrRNA 16S rRNA (Other) Bhatt Apr 25, 2024
218518 pUCIDT-AMP-Bv16SrRNA 16S rRNA (Other) Bhatt Apr 25, 2024
217921 pGEX-4T_CIP2A_1-560 CIP2A (Homo sapiens) Westermarck Apr 25, 2024
216227 TDP-43 mCerulean TDP-43 (Homo sapiens) Lee Apr 25, 2024
216225 TDP-43 mRuby TDP-43 (Homo sapiens) Lee Apr 25, 2024
216226 TDP-43 mRuby K84ONBK Transactive response DNA binding protein of 43 kDa (Homo sapiens) Lee Apr 25, 2024
215346 Spacer Switch Plasmid OpaD spacer; Chloramphenicol Resistance Cassette (Other) Seifert Apr 25, 2024
215348 pYZ1389 Nla CRISPRi Genes (Cas5, Cas8c, Cas7) (Other) Seifert Apr 25, 2024
204796 Fusion of West Nile NS2B-NS3 proteins West Nile NS2B-NS3 fusion (Other) von Delft Apr 25, 2024
204815 Fusion of Zika NS2B-NS3 proteins Zika NS2B-NS3 fusion (Other) von Delft Apr 25, 2024
204790 MERS Mpro - His6-SUMO with autoprocessing - MSAVMQ/SGLVKM---MGVVMQ/SGVRKVTYGTAHWL MERS Mpro (Other) von Delft Apr 25, 2024
207169 pLV-TET2Puro-gal4DBD-miniVPR-HA Gal4DBD-miniVPR (Synthetic) Bersten Apr 25, 2024
207170 pLV-REPORT (PGK) 5xGRE-NanoLuc NanoLuciferase (Synthetic), d2eGFP (Synthetic), 5x GRE (Synthetic) Bersten Apr 25, 2024
207171 pEF-IRES-puro6 gal4DBD-HIFCAD myc tag Gal4DBD-HIF1a-CAD Myc tag linker (Homo sapiens) Bersten Apr 25, 2024
207172 pEF-IRES-puro6 +gal4DBDHIFCAD pGalO linker Gal4DBD-HIF1a-CAD GalO linker (Homo sapiens) Bersten Apr 25, 2024
207173 pLV-tet2puro-gal4DBD-HIFCAD Gal4DBD-HIF1a-CAD (Homo sapiens) Bersten Apr 25, 2024
207174 pENTR1a-CRISPRoffv2.1 CRISPRoffv2.1 (Synthetic) Bersten Apr 25, 2024
207175 pLV-EgI-NeoR Empty Bersten Apr 25, 2024
207176 pLV-EgI-BlastR Empty Bersten Apr 25, 2024
207177 pLV-EgI-HygroR Empty Bersten Apr 25, 2024
207178 pLV-EgI-ZeoR Empty Bersten Apr 25, 2024
207179 pLV-SFFVp-gI-BlastR Empty Bersten Apr 25, 2024
207180 pLV-EF1a-CRISPRoffv2.1-IRES-BlastR CRISPRoffv2.1 (Synthetic) Bersten Apr 25, 2024
207181 pLV-SFFVp-CRISPRoffv2.1-IRES-BlastR CRISPRoffv2.1 (Synthetic) Bersten Apr 25, 2024
207182 pLV-SV40p-gI-BlastR Empty Bersten Apr 25, 2024
208573 pLV-REPORT(PGKCMV)-nucTomato-hygro mnucTomato (Synthetic), d2nucEGFP (Synthetic), HygroR Bersten Apr 25, 2024
208574 pLV-REPORT(PGK/CMV)-GtwyA mnucTomato (Synthetic), HSVtk, Neomycin, d2nucEGFP (Synthetic) Bersten Apr 25, 2024
208575 pLV-REPORT (PGK) 12xHRE-NanoLuc NanoLuciferase (Synthetic), d2eGFP (Synthetic), 12xHRE Bersten Apr 25, 2024
208576 pLV-REPORT (PGK) NanoLuc NanoLuciferase (Synthetic), d2eGFP (Synthetic), Empty response element Bersten Apr 25, 2024
204788 Zika NS5 RdRp Zika NS5 RdRp domain (Other) von Delft Apr 25, 2024
217301 MEK1-E102-I103del-V5 MAP2K1 (Homo sapiens) Der Apr 24, 2024
217297 WT-MEK1-V5 MAP2K1 (Homo sapiens) Der Apr 24, 2024
217378 pcDNA3.4-GFP-TEV-B55 B55 (Homo sapiens) Peti Apr 24, 2024
207553 AAVS1 EGFP-Sec61B TET inducible EGFP-Sec61B (Homo sapiens) Schmidt Apr 24, 2024
218192 MBP-Benzonase nucA (Other) Arrowsmith Apr 24, 2024
207580 AAVS1 SNAP-Sec61B TET inducible SNAPTag-Sec61B (Homo sapiens) Schmidt Apr 24, 2024
217832 p4A8_S7T_BC 4A8 variant Fab (Homo sapiens) Whitehead Apr 24, 2024
207549 AAVS1 LAMP1-mNeonGreen HRD TET inducible LAMP1-mNeonGreen (Homo sapiens) Schmidt Apr 24, 2024
207551 AAVS1 EGFP-LC3B HRD TET inducible EGFP-LC3B (Homo sapiens) Schmidt Apr 24, 2024
207552 AAVS1 EGFP-GABARAPL1 HRD TET inducible EGFP-GABARAPL1 (Homo sapiens) Schmidt Apr 24, 2024
216732 pLV(gRNA)-CMV-eGFP-U6(sgCTG) sgCTG lentiviral guide RNA with eGFP tag (Synthetic) Dion Apr 24, 2024
216733 pLenti-U6-sgCTG-CAG-Cas9D10A nickase-Blast Cas9-D10A nickase and sgCTG (Other) Dion Apr 24, 2024
216734 pAAV-U6-sgCTG-CMV-GFP sgCTG (Synthetic) Dion Apr 24, 2024
216735 pX551-miniCMV-SpCas9D10A nickase Cas9-D10A nickase (Other) Dion Apr 24, 2024
216736 pAAV-nEF-SpCas9D10A nickase Cas9-D10A nickase (Other) Dion Apr 24, 2024
216737 pAAV-CMV-SpCas9D10A nickase Cas9-D10A nickase (Other) Dion Apr 24, 2024
207545 SNAP-LC3 HRD SNAPtag with internal PuroR cassette flanked by human LC3B locus sequences (Homo sapiens) Schmidt Apr 24, 2024
207105 SHLD3 KO sgRNA #1 CGCTATCAAGATTTATACCT (Homo sapiens) Schmidt Apr 24, 2024