Skip to main content

PLVX_SPTA1_IGF2BP1_IRES_PURO
(Plasmid #100016)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100016 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PLVX-SPTA1-IRES-PURO
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 8485
  • Total vector size (bp) 10201
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Insulin like growth factor 2 mRNA binding protein 1
  • Alt name
    IMP-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1734
  • GenBank ID
    NM_006546.3
  • Entrez Gene
    IGF2BP1 (a.k.a. CRD-BP, CRDBP, IMP-1, IMP1, VICKZ1, ZBP1)
  • Promoter SPTA1 erythroid specific promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CCAGACTTTCAAGAAGAGAA
  • 3′ sequencing primer AGGTGTATCTTATACACGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PLVX_SPTA1_IGF2BP1_IRES_PURO was a gift from Jeffery Miller (Addgene plasmid # 100016 ; http://n2t.net/addgene:100016 ; RRID:Addgene_100016)
  • For your References section:

    IGF2BP1 overexpression causes fetal-like hemoglobin expression patterns in cultured human adult erythroblasts. de Vasconcellos JF, Tumburu L, Byrnes C, Lee YT, Xu PC, Li M, Rabel A, Clarke BA, Guydosh NR, Proia RL, Miller JL. Proc Natl Acad Sci U S A. 2017 Jul 11;114(28):E5664-E5672. doi: 10.1073/pnas.1609552114. Epub 2017 Jun 26. 10.1073/pnas.1609552114 PubMed 28652347