pAAV-hSyn-hChR2(H134R)-EYFP (PV2371)
(Plasmid
#100053)
-
PurposeAAV expression of humanized ChR2 with H134R mutation fused to EYFP driven by human Synapsin I promoter for optogenetic activation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehChR2(H134R)
-
SpeciesSynthetic
-
Insert Size (bp)1662
-
MutationH134R, humanized
- Promoter hSyn
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ccacgcgaggcgcgagatag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Penn Vector Core PV2371
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-hChR2(H134R)-EYFP (PV2371) was a gift from Karl Deisseroth (Addgene plasmid # 100053)
