pAAV-Ef1a-DIO ChETA-EYFP (PV2232)
(Plasmid
#100058)
-
PurposeAAV expression of humanized ChR2 with E123T/H134R mutations fused to EYFP driven by EF1a promoter for optogenetic activation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100058 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehChR2(E123T/H134R)-EYFP
-
Alt nameChETA-EYFP
-
SpeciesChlamydomonas reinhardtii
-
Insert Size (bp)1662
-
MutationE123T, H134R humanized
- Promoter Ef1a
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer ggccagcttggcacttgatg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Penn Vector Core PV2232
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DIO ChETA-EYFP (PV2232) was a gift from Karl Deisseroth (Addgene plasmid # 100058)