Skip to main content
Addgene
Open Menu

AAV-Ef1a-DIO eNpHR 3.0-EYFP (PV2239)
(Plasmid #100067)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100067 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    eNpHR 3.0
  • Species
    Natronomonas pharaoni
  • Insert Size (bp)
    1683
  • Mutation
    ER export at 3' end of gene. Trafficking signal (TS) in between gene and fluorophore.
  • Promoter EF1a
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer ggccagcttggcacttgatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Penn Vector Core PV2239

This plasmid contains the human elongation factor-1a promoter. Golgi export trafficking signal (TS) sequence is KSRITSEGEYIPLDQIDINV. ER export sequence is FCYENEV.

For additional information please visit - http://www.optogenetics.org

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-Ef1a-DIO eNpHR 3.0-EYFP (PV2239) was a gift from Karl Deisseroth (Addgene plasmid # 100067)
Related items: