pAAV-hSyn-eNpHR 3.0-EYFP (PV2233)
(Plasmid
#100070)
-
PurposeAAV expression of eNpHR 3.0 fused to EYFP driven by humanized Synapsin promoter for optogenetic inhibition
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100070 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeNpHR 3.0
-
SpeciesNatronomonas pharaoni
-
Insert Size (bp)1683
-
MutationTrafficking Signal (TS) ER Export Signal
- Promoter hSyn
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI, AgeI (not destroyed)
- 3′ cloning site EcoRI, HinDIII (not destroyed)
- 5′ sequencing primer ccacgcgaggcgcgagatag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Penn Vector Core PV2233
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-eNpHR 3.0-EYFP (PV2233) was a gift from Karl Deisseroth (Addgene plasmid # 100070)