pET26_MraYaa
(Plasmid
#100166)
-
Purposerecombinant expression of target protein as an MBP-His tag fusionat the N-terminus of target protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100166 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET26
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemraY (phospho-MurNAc-pentapeptide translocase)
-
SpeciesAquifex Aeolicus
-
Insert Size (bp)1082
- Promoter T7
-
Tag
/ Fusion Protein
- MBP-His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CAGATGTCCGCTTTCTGGTATG
- 3′ sequencing primer T7_reverse (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET26_MraYaa was a gift from Seok-Yong Lee (Addgene plasmid # 100166 ; http://n2t.net/addgene:100166 ; RRID:Addgene_100166) -
For your References section:
Crystal structure of MraY, an essential membrane enzyme for bacterial cell wall synthesis. Chung BC, Zhao J, Gillespie RA, Kwon DY, Guan Z, Hong J, Zhou P, Lee SY. Science. 2013 Aug 30;341(6149):1012-1016. doi: 10.1126/science.1236501. 10.1126/science.1236501 PubMed 23990562