Skip to main content

pCAGGS-hPhyB621-mCherry-HRasCT
(Plasmid #100282)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100282 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Backbone manufacturer
    Junichi Miyazaki (Osaka University, Japan)
  • Backbone size w/o insert (bp) 4870
  • Total vector size (bp) 8551
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Phytochrome B (1-621 aa)
  • Alt name
    PhyB (1-621 aa)
  • Species
    A. thaliana (mustard weed)
  • Mutation
    Human codon optimized PhyB (1-621 aa)
  • GenBank ID
    NM_001335612.1
  • Entrez Gene
    PHYB (a.k.a. AT2G18790, HY3, MSF3.17, MSF3_17, OOP1, OUT OF PHASE 1, PHYTOCHROME B, phytochrome B)
  • Promoter CAG promoter
  • Tag / Fusion Protein
    • mCherry fused with HRas C-terminus for plasma membrane localization. (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer catgttcatgccttcttctttttcc
  • 3′ sequencing primer agatgctcaaggggcttcatgatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expression vector of PhyB621-mCherry-HRasCT in mammalian cells. Of note, the expression level of PIF3-mEGFP must be comparable or lower than that of PhyB. We usually co-transfect pCAGGS-PhyB621-mCherry-HRasCT and pCAGGS-PIF3-mEGFP plasmids into HeLa cells with lipofection in a 50:1 ratio.

mCherry has a G229L mutation that does not affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS-hPhyB621-mCherry-HRasCT was a gift from Kazuhiro Aoki (Addgene plasmid # 100282 ; http://n2t.net/addgene:100282 ; RRID:Addgene_100282)
  • For your References section:

    Efficient synthesis of phycocyanobilin in mammalian cells for optogenetic control of cell signaling. Uda Y, Goto Y, Oda S, Kohchi T, Matsuda M, Aoki K. Proc Natl Acad Sci U S A. 2017 Oct 24. pii: 201707190. doi: 10.1073/pnas.1707190114. 10.1073/pnas.1707190114 PubMed 29078307