pCAGGS-hPhyB621-mCherry-HRasCT
(Plasmid
#100282)
-
PurposeExpresses Phytochrome B (1-621 aa) fused with mCherry and Hras C-terminus in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100282 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAGGS
-
Backbone manufacturerJunichi Miyazaki (Osaka University, Japan)
- Backbone size w/o insert (bp) 4870
- Total vector size (bp) 8551
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePhytochrome B (1-621 aa)
-
Alt namePhyB (1-621 aa)
-
SpeciesA. thaliana (mustard weed)
-
MutationHuman codon optimized PhyB (1-621 aa)
-
GenBank IDNM_001335612.1
-
Entrez GenePHYB (a.k.a. AT2G18790, HY3, MSF3.17, MSF3_17, OOP1, OUT OF PHASE 1, PHYTOCHROME B, phytochrome B)
- Promoter CAG promoter
-
Tag
/ Fusion Protein
- mCherry fused with HRas C-terminus for plasma membrane localization. (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer catgttcatgccttcttctttttcc
- 3′ sequencing primer agatgctcaaggggcttcatgatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Expression vector of PhyB621-mCherry-HRasCT in mammalian cells. Of note, the expression level of PIF3-mEGFP must be comparable or lower than that of PhyB. We usually co-transfect pCAGGS-PhyB621-mCherry-HRasCT and pCAGGS-PIF3-mEGFP plasmids into HeLa cells with lipofection in a 50:1 ratio.
mCherry has a G229L mutation that does not affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS-hPhyB621-mCherry-HRasCT was a gift from Kazuhiro Aoki (Addgene plasmid # 100282 ; http://n2t.net/addgene:100282 ; RRID:Addgene_100282) -
For your References section:
Efficient synthesis of phycocyanobilin in mammalian cells for optogenetic control of cell signaling. Uda Y, Goto Y, Oda S, Kohchi T, Matsuda M, Aoki K. Proc Natl Acad Sci U S A. 2017 Oct 24. pii: 201707190. doi: 10.1073/pnas.1707190114. 10.1073/pnas.1707190114 PubMed 29078307