Skip to main content

pCMV_mEm_4GS_LF82_280
(Plasmid #100403)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100403 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 4502
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LF82_280
  • Insert Size (bp)
    1146
  • Promoter CMV
  • Tag / Fusion Protein
    • mEmerald (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ACTTCTGCTCTAAAAGCTGCGG
  • 3′ sequencing primer CACTGCATTCTAGTTGTGGTTTGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV_mEm_4GS_LF82_280 was a gift from Alan Huett (Addgene plasmid # 100403 ; http://n2t.net/addgene:100403 ; RRID:Addgene_100403)
  • For your References section:

    A multi-phenotypic imaging screen to identify bacterial effectors by exogenous expression in a HeLa cell line. Collins A, Huett A. Sci Data. 2018 May 15;5:180081. doi: 10.1038/sdata.2018.81. 10.1038/sdata.2018.81 PubMed 29762554