pLH_Scr15
(Plasmid
#100537)
-
PurposeCEN/ARS plasmid with expression cassettes for PhyBNT-CreN and PIF3-NLS-CreC fusion proteins for red/far-red light-regulated Cre recombinase activity in Saccharomyces cerevisiae.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100537 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepL1A0*B0*_Leu
- Backbone size w/o insert (bp) 4885
- Total vector size (bp) 11657
-
Vector typeYeast Expression, Cre/Lox, Synthetic Biology
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePhytochrome B
-
Alt namePhyB
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1863
-
MutationN-terminal version of PhyB (AA 1-621)/ Mutation of nucleotide 576 C-->A
-
Entrez GenePHYB (a.k.a. AT2G18790, HY3, MSF3.17, MSF3_17, OOP1, OUT OF PHASE 1, PHYTOCHROME B, phytochrome B)
- Promoter TDH3
-
Tag
/ Fusion Protein
- CreN (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCAATAGCGCATCAAGAAAA
- 3′ sequencing primer CCCTGAAATTATTCCCCTAC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePhytochrome interacting factor 3
-
Alt namePIF3
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1572
-
Entrez GenePIF3 (a.k.a. AT1G09530, F14J9.19, F14J9_19, PAP3, PHOTOCURRENT 1, PHYTOCHROME INTERACTING FACTOR 3, PHYTOCHROME-ASSOCIATED PROTEIN 3, POC1, phytochrome interacting factor 3, purple acid phosphatase 3)
- Promoter FBA1
-
Tags
/ Fusion Proteins
- SV40 NLS (C terminal on insert)
- CreC (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCCTTCTTCTTCGCCCA
- 3′ sequencing primer AAGAAAAGAGCCGACCAA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLH_Scr15 was a gift from Bernd Müller-Röber (Addgene plasmid # 100537 ; http://n2t.net/addgene:100537 ; RRID:Addgene_100537) -
For your References section:
L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast. Hochrein L, Mitchell LA, Schulz K, Messerschmidt K, Mueller-Roeber B. Nat Commun. 2018 May 22;9(1):1931. doi: 10.1038/s41467-017-02208-6. 10.1038/s41467-017-02208-6 PubMed 29789561