(p)odr-3::GFP::EGL-4
(Plasmid
#100897)
-
PurposeGFP and the EGL-4 cDNA driven by the odr-3 promoter, which expresses in the AWA, AWB, and AWC olfactory sensory neurons in C. elegans. unc-54 3'UTR in sequence as well.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100897 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPD49.26
-
Backbone manufacturerAndy Fire
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name56-2741: odr-3 promoter
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)2686
- Promoter odr-3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SphI (unknown if destroyed)
- 3′ cloning site EcoRV (unknown if destroyed)
- 5′ sequencing primer atctcaacatagtagatttttaaa
- 3′ sequencing primer CCAATCCCtatctaaaaaaaca
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
(p)odr-3::GFP::EGL-4 was a gift from Noelle L'Etoile (Addgene plasmid # 100897 ; http://n2t.net/addgene:100897 ; RRID:Addgene_100897) -
For your References section:
Nuclear entry of a cGMP-dependent kinase converts transient into long-lasting olfactory adaptation. Lee JI, O'Halloran DM, Eastham-Anderson J, Juang BT, Kaye JA, Scott Hamilton O, Lesch B, Goga A, L'Etoile ND. Proc Natl Acad Sci U S A. 2010 Mar 30;107(13):6016-21. Epub 2010 Mar 10. 10.1073/pnas.1000866107 PubMed 20220099