(p)odr-3::GFP::EGL-4
(Plasmid #100897)

• Purpose: GFP and the EGL-4 cDNA driven by the odr-3 promoter, which expresses in the AWA, AWB, and AWC olfactory sensory neurons in C. elegans. unc-54 3'UTR in sequence as well.
• Depositing Lab: Noelle L'Etoile
• Publication: Lee et al Proc Natl Acad Sci U S A. 2010 Mar 30;107(13):6016-21. Epub 2010 Mar 10.

Backbone

• Vector backbone: pPD49.26
• Backbone manufacturer: Andy Fire
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 56-2741: odr-3 promoter
• Species: C. elegans (nematode)
• Insert Size (bp): 2686
• Promoter: odr-3

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SphI (unknown if destroyed)
• 3′ cloning site: EcoRV (unknown if destroyed)
• 5′ sequencing primer: atctcaacatagtagatttttaaa
• 3′ sequencing primer: CCAATCCCtatctaaaaaaaca

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry